Chapter One

DNA - The Language of Life

A Hot Topic

Why another book on the origin of life? The number of titles on this subject seems to have accelerated in recent years. It certainly is a hot topic in the scientific community, though to some outside that community, this might come as something of a surprise.

After all, didn't Charles Darwin explain life's origin in his theory of evolution? Well, no he didn't. His book was titled the "The Origin of [Distinct] Species", not the "The Origin of Life". Oh, but didn't we cover this in high school biology? Didn't the first life arise out of the "primordial soup"? As we shall see, there is not yet any evidence that it did.

As part of my research for this book I listened to the lecture series "Origins of Life", taught by Professor Robert M. Hazen for The Teaching Company . As much as I enjoyed both the content and style of this series, by the end it had confirmed for me what Professor Hazen was honest enough to declare right at the beginning:

At this point in time we have no explanation as to how the building blocks of life, which may have been common in the natural environment of the early Earth, gave rise to cellular life. Amino acids, sugars and lipids are simple molecules, and to understand how they could come to be organized into the staggering complexity of a living cell, whether in one step or in many steps, is in my view, light years beyond the limits of current science.

What I hope to emphasize in this book is that such organization requires mind-boggling amounts of information. In fact, I believe it is the capacity of chemical systems to encode sufficient information for their growth and replication, and their ability to utilize this data that distinguishes living things from non-living things.

You may have heard some scientists suggest that the three key requirements for life are water, a source of energy, and carbon-based molecules. I argue in this book that they overlook a fourth requirement without which life cannot exist. That requirement is information. As someone who has spent most of his career working in information technology, I feel I have a unique perspective that justifies another book on origins.

The Inheritance of Information

Where are these instructions stored? All but my oldest readers will have learned something about this in high school, but most will probably appreciate some revision. I also ask lay readers to be patient while I go through some of the technical details over the next two pages. These details lay the foundation for arguments that I develop in Chapter 3 and beyond.

The discovery of the mechanism, by which living organisms pass on to the next generation the information that defines them, brought about a revolution in biology. During the 1940s, scientists determined that this information is contained in a complex molecule in the nucleus of each cell. They called it deoxyribo nucleic acid, or DNA for short. In 1953, scientists James Watson and Francis Crick finally worked out the structure of the molecule.

DNA has the form of a double helix. Two long phosphate chains spiral around each other, much like the rails of a twisted ladder. The structure is depicted, in stylized form, on the front cover of this book. The rungs of the ladder are made from pairs of smaller molecules known as nucleobases, or bases for short. There are four distinct base types, namely adenine, guanine, cytosine and thymine. These are represented by the letters A, G, C and T respectively. Each type of base on one strand forms a bond with just one type of base on the other strand. This is called complementary base pairing. Adenine is always paired with thymine, and vice versa. Similarly, cytosine is paired with guanine and vice versa.

It is the unique sequence of these base pairs that carries the blueprint of life to the next generation. In the sample below, a sequence of fifty bases from the human betaglobin gene ii is shown.

TCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTT

 

Back to Top | Full Screen